Homology and Analogy

a.                   The two species with homologous traits that I chose to compare are the whale and manatee.

b.                  Both the whale and manatee have fins for swimming and are adapted for marine life.  In addition, whales and manatees give birth to calves.

c.                   Both whales and manatees have a shared ancestry with land mammals.  Their genetic relationship can be explained by the bone structure in their flippers. Each possesses bone structure that is similar to those shared by terrestrial animals (very similar to a human hand!) The manatees’ most closest relative may be the elephant and the whale’s, a human.

bones in a whale flipper

bones in a manatee flipper

d.                  image of each species

a. The two species with analogous traits that I selected for comparison are the shark and the whale.

Both are marine animals that live in the ocean.

b. The analogous trait shared by both the shark and the whale are their fins for swimming. Each have a top fin, two side fins and a tail fin which help them glide for the water. Their skin also has adapted them for marine life.

c. I believe the common ancestor shared by both the shark and the whale is the reptile.  Reptiles do not have fins and have adapted to life on land.

d. Images of the two analogous species

mRNA

Ready for decoding....

ATAGTACCAACTCTGAAGTGGCTTGAGTACGCAAAGACTCAGTAAATTTATCTCCG

Who influenced Darwin the Most?

1.       The individual I would argue had the most positive influence over Darwin’s development of his natural selection theory is Thomas Malthus.

2.       Thomas Malthus, a political economist, argued in his “An Essay on the Principle of Population as it affects the Future Improvement of Society” that the food supply would never be able to keep up with population growth and that other forces such as disease or persons marrying later in life, kept the population in check. (http://evolution.berkeley.edu/evolibrary/article/_0_0/history_07).

3.       Mathus’s theory discusses why we are not up to our eyeballs in rabbits by providing a rationale for the first three bulleted points and bullet 9: 1) All organisms have the potential at growing exponentially; Mathus point, human populations can also grow exponentially; 2) What is preventing organisms from reproducing at their potential, Mathus point other forces, e.g., disease, waiting for marriage, keep population growth in check; 3) Resources are limited, Mathus point, land space is limited; and 9) individual do not change populations do, Mathus writings also focused on changes in groups of humans rather than individuals.

4.       After reading Mathus’s work, Darwin was quoted as saying: “It all once struck me that under these circumstances favorable variations would tend to be preserved and unfavorable ones would be destroyed. The result of this would be the formation of a new species (Jurmain et al., 2010, pg 36).  It is this statement by Darwin that confirms that Mathu’s work was pivotal in helping him develop his natural selection theory.

5.       Darwin knew his theory was very controversial at the time and delayed his publication for many years. His views even differed from those of his wife Emma (Jurmain et al.  pg 36). For that reason, he delayed publication for 15 years, from his early draft in 1844 to the publication "On the Origin of Species" in 1859.  Today’s Darwin’s work continue to be contested by fundamentalists, although the  Catholic church is more accepting of evolutionary processes (Jurmain et al. pg 44).