Human Variation

Humans who move to higher altitudes will experience the following environmental stresses: hypoxia which is caused by a reduction in the concentration of oxygen, more intense climatic conditions such as low humidity, greater exposure to the sun, cold and wind and rough terrain and reduced nutrition.  In addition, infant mortality is greater at higher altitudes as a result of a condition called preeclampsia.  Preeclampsia causes a severe elevation in blood pressure in pregnant women after the twentieth gestation week. All of these conditions disturb homeostasis in humans and impact their ability to thrive at the higher altitudes.

Humans have developed a number of mechanisms to adapt to living at higher altitudes.  Individuals who have recently moved to a higher altitude will acclimatize in a few days by experiencing an increased respiratory and heart rate. In addition a facultative response will occur when the body produces more red blood cells to increase the oxygen supply to internal organs and tissues.  Over time, natural selection will act on individuals born at higher altitudes since they will show developmental characteristics such as increased chest size to accommodate a greater lung volume and larger heart.  Cultural products have also been developed such as the medicine Diamox which is designed to help ease many of the symptoms experienced during the acclimatization process.

The benefits of studying human variation across environmental clines, is that it allows scientists to understand the human’s evolutionary response to changing environmental conditions. The information gained from these studies can then be used to predict how humans will respond to future climate changes such as global warming.

Race is not a useful measure when looking at how humans adapt to changes in altitude.  While certain groups of individuals such as the Tibetans and Quechua have shown a remarkable ability to survive at altitudes as high as 12,000 feet, there is no evidence that suggests that these individuals have a greater capacity to survive in these conditions than other groups of individuals.  Over thousands of years, natural selection has acted on these groups of individuals which has allowed their bodies to adapt to the extreme living conditions. 

Language Experiment...

Part 1

Since I didn’t have a lot of willing participants for this assignment, I had to enlist the help of my brother who is the most easy going person I know.  Initiating the conversation was difficult since neither one of us knew what to talk about.  In order to get the conversation going, I used a calendar as a prop and began by pointing to dates on the calendar to see if he knew what I was asking him.  The first questions were easy as he remembers almost everyone’s birthday.  The harder question for him was our parent’s anniversary.  I used various symbols such as holding up numbers for the number of years they were married, to the symbol of people walking, to represent two people walking together down an aisle, to hands together to symbolize prayer. (If any of these symbols happen to overlap with ASL, it would have been purely coincidental since I don’t know ASL).  He got the individual meanings of each symbol, and came close to guessing the number of years married, 44, and the people walking together symbol, and that hands together in prayer meant church, so after repeating these symbols several times, he was able to understand that their combined meaning was anniversary.  I am not sure if the entire communication using hand expressed symbols lasted 15 minutes, although it felt like at least that much time had lapsed for him to get the meaning of each question I was asking him using only hand expressed symbols.

Part 2

Before this assignment, I had printed out the “just so stories” posted on last week’s blog about mimic the octopus.  I decided to read him each story without moving my hands, changing the inflection of my voice or looking up at all during the reading.  I read each story in an even consistent tone of voice, although I broke character a couple of times by laughing because some of those stories are so funny, its hard not to laugh.  At the end of reading, I asked him in the same tone of voice which story he liked the best.  He said they all sounded the same to him.  Anyone who took the time to read everyone’s “just so story” knows that each story was very unique and while some had some similar themes none of the stories were alike.  Therefore it was easy to conclude that without including any other elements of communication, such as changing the inflection of the voice or head movement or eye contact, that the words did not seem convey different meanings. I recall from some of my previous studies that it has been cited that approximately 90% of language is non-verbal. I followed up with this by reading an article online that also referenced that 70% to 90% of language is in fact non verbal (http://faculty.buffalostate.edu/smithrd/UAE%20Communication/Unit2.pdf).  It is clear from conducting this experiment and the literature on language that non-verbal language plays a huge part in the process of communication.  Therefore it gives us some clues to how our early ancestors were able to expand non verbal communication into a much more elaborate form communication using the alphabet or characters like those used in Asian cultures.  Although the fossil record cannot provide a complete picture about how language evolved in hominins or Neanderthals, it is possible to understand how simple non verbal cues could lead to a much more elaborate system of language that we use today.  It is amazing to me that some symbols are universal no matter what language you speak. For example, the flashing symbol of a hand, clearly means to “stop” and the picture of someone walking means “go.”

The Piltdown Hoax

In the small village of Piltdown, an amateur archaeologist Charles Dawson happened to come across a fragment of an ancient human skull in the year 1912.  Upon making this discovery, he asked his fellow colleagues, Arthur Smith Woodward and Father Pierre Teilhard to join him in his search for more evidence.  Later, it was again Dawson who made another discovery of what he claimed was a human jawbone.  The evidence which was pieced together and named “Piltdown Man” brought notoriety to England’s otherwise barren archaeological community. It also caught the attention of anatomist Arthur Keith who had hypothesized that the humans had developed large brains before walking upright.  The discovery of Piltdown man supported Keith’s findings thereby galvanizing Piltdown man as a significant contribution not only to the archaeological world but to the scientific world as well. The fluorine testing performed on the skull after World War II was the first evidence that the skull was a fake.  The discovery of the hoax sent an important message to the scientific community that scientists are indeed human and are not always out for the best interests of the community.

It seems even today that the true motives of Charles Dawson are not known. However, upon Charles Darwin’s death, England had not made any significant archaeological discoveries and was itching for a chance to be in the limelight. Whether it was Dawson who planted the evidence at the archaeological site, or if it was someone else, it was clearly human ego that motivated Dawson to make the discovery known to the world.  The most negative side effect of the discovery is that it held back the scientific community for 40 years from advancing its knowledge.

The most positive aspect of discovering that the skull was a fake was the awareness that it brought to the scientific community that if something like this could happen, a better system was needed for testing scientific evidence.  The fluorine testing was one of the key tests used to determine that the skull was in fact not as old as Charles Darwson claimed.  Also, the scientists who re-examined the skull noticed that pieces had been left out of the skull in order to make the jawbone appear to fit and that the teeth had been filed down to make them look human.

                “To Err is Human, to Forgive Devine” as Alexander Pope is quoted as saying. Therefore, it is not possible to remove the “human” factor from science, nor would it make sense to do so.  There is no such thing as the perfect setting to conduct research.  For example, in Psychology I learned about the “observer effect” and that humans don’t behave the same way when being observed.  Also research conducted in a controlled environment such as a laboratory setting also yield different results than if conducted in a natural setting.  Therefore, the only way for researchers to obtain the best possible data is by testing and re-testing.  Whatever data shows to be consistent over time is the most reliable.

                The lesson learned here is one in critical thinking. Throughout our life it will be important to use critical thinking to weigh and evaluate the credibility of information that is presented whether it is looking at scientific methods or simply making a personal purchase.  I thought it was interesting to read in our text that collagen creams do not really work.  Now, I know not to waste my money!

Dentition Patterns in Primates

a. In addition to the environment of the five primates listed, I also provided a brief description of their diet, which I will later use to help describe the trait of dentition patterns that I will be examining.

Lemurs (prosimians) are the island variety of primate whose primary residence is Madagascar, which is located off the East Coast of Africa. However, a small population of lemurs also resides in the nearby Comoros Islands. While most favor sources of food from trees and plants, some specific species of Lemur are also omnivorous and eat insects, eggs and lizards.

Spider monkeys (new world monkey) call the rainforests of Central America’s Mexico and South America’s Bolivia, Brazil and Motto Grasso home.  The rainforest provides an ideal environment for this tree loving monkey. Their food of choice is fruit but they are also known to dine on insects, eggs, and even tree bark.

Baboon (old world monkey) are mainland monkeys so to speak, as they reside on the main continent of Africa.  Unlike their tree dwelling counterparts, baboons are highly adaptable creatures and can live in a variety settings. As a result, their diets are also varied and include the main staple of grass and small quantities of meat such as antelope and fish.

Gibbons are considered endangered and inhabit the subtropical rain forests on the Far East end of the globe which includes the Southeast, South and East Asia.  Gibbons are arboreal and spend most of their time in the trees which provides a large source of their diet. While fruit is their food of choice they also are known to dine on twigs and bird eggs.

Chimpanzees are native to Africa including Guinea to Western Uganda and Tanzania.  They also inhabit the rainforests of these regions as well as the grassy lands of the Savannah.  They are omnivores and eat a variety of plants, but also snack on ants, termites, the occasional bird, or even a monkey or two!

b. The specified character trait for Lemurs, Spider Monkeys, Baboons, Gibbons and Chimpanzees are that they are all considered heterodonts.  A heterodont, simply means that they have different types of teeth in the tooth row (combination of incisors, canines and pre molars and molars).  This feature distinguishes them from other types of mammals such as horses who have rows of similar type of teeth, e.g., molars for chewing grass. 

c. The dentition patterns of the five primates are represented by their shared dietary pattern of being omnivorous animals.  The four types of teeth which all primates possess are as follows: incisors, canines, premolars and molars.  

d.  images of the shared trait.  Notice the shared similarities of incisors, canine teeth, molars and premolars in the different types of primates.  The pictures are as follows, Lemur, Spider Monkey examining another Spider monkey's teeth, Baboon, Gibbon and Chimpazee. Couldn't find an image of the Lemur's teeth, but thought this was a cute subsitute.

                    

As shown in the images above, the different teeth structure of each type of primate is slightly varied and can best be explained by the environment where they live.  For example, baboons and chimpazees which are more of the land dwelling type of primate have longer canines and incisors which have been adapted to allow them to also eat small mammals.  Without this type of teeth, they would not have the ability to tear the flesh of these mammals. The tree dwelling monkeys such as the Lemur, Gibbon and Spider monkeys bodies are adapted to tree life.  As a result of tree life their diets are also different  than the baboon and chimpazee.  While they also have incisors and canines which allow them tear into their food, their canines and incisors are smaller and are adapted to eating mostly plant type food, small insects and eggs.

Homology and Analogy

a.                   The two species with homologous traits that I chose to compare are the whale and manatee.

b.                  Both the whale and manatee have fins for swimming and are adapted for marine life.  In addition, whales and manatees give birth to calves.

c.                   Both whales and manatees have a shared ancestry with land mammals.  Their genetic relationship can be explained by the bone structure in their flippers. Each possesses bone structure that is similar to those shared by terrestrial animals (very similar to a human hand!) The manatees’ most closest relative may be the elephant and the whale’s, a human.

bones in a whale flipper

bones in a manatee flipper

d.                  image of each species

a. The two species with analogous traits that I selected for comparison are the shark and the whale.

Both are marine animals that live in the ocean.

b. The analogous trait shared by both the shark and the whale are their fins for swimming. Each have a top fin, two side fins and a tail fin which help them glide for the water. Their skin also has adapted them for marine life.

c. I believe the common ancestor shared by both the shark and the whale is the reptile.  Reptiles do not have fins and have adapted to life on land.

d. Images of the two analogous species

mRNA

Ready for decoding....

ATAGTACCAACTCTGAAGTGGCTTGAGTACGCAAAGACTCAGTAAATTTATCTCCG